Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr19:19653103-19653187
Genomic Sequence:  (84 bases)
tagaaatgtacagaatatggggaaactctcattgctctc
atctccattcaaagacacgtgtcagtgcacactggagat
ggatgg
Translated Genomic Sequence:  (28 residues; this is a NON-canonical finger sequence)
ZKCTEYGETLIALISIQRHVSVHTGDGW
Stop codon count:  1
HMMER E-value  :  1.4E-4
HMMER bit score  :  0.8