Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:4742764-4742848
Genomic Sequence:  (84 bases)
tacacctgccccgaatgtggcaaaggcttcagcaagacg
tcccacttgaccaagcaccagcgcacacacacgggcgag
cggcct
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YTCPECGKGFSKTSHLTKHQRTHTGERP
Stop codon count:  0
HMMER E-value  :  9.2E-18
HMMER bit score  :  56.6