Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:4742596-4742680
Genomic Sequence:  (84 bases)
tacccgtgccccgagtgtgggaagcgcttcagccagagc
tccagcctggtcatccaccgcaggacacacagcggggag
cggccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YPCPECGKRFSQSSSLVIHRRTHSGERP
Stop codon count:  0
HMMER E-value  :  4.7E-18
HMMER bit score  :  57.6