Motif identified by HMMER search
Type:  KRAB-B
Genomic coordinates:  chr7:148240164-148240257
Genomic Sequence:  (93 bases)
tcctcaaaaacaggacttgtgtgctgccttacgagggaa
agagagaaagattttattagctcaaacagccaccttcca
gtctccaagtctccg
Translated Genomic Sequence:  (31 residues)
SSKTGLVCCLTREREKDFISSNSHLPVSKSP
Stop codon count:  0
HMMER E-value  :  2.0E-4
HMMER bit score  :  0.2