Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:148239287-148239371
Genomic Sequence:  (84 bases)
ttttcgtgtcccgagtgtaacaaaagtttccgcctcaag
agaagcctgaaagcccacgggctgcagcacattgggaag
cggccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
FSCPECNKSFRLKRSLKAHGLQHIGKRP
Stop codon count:  0
HMMER E-value  :  3.4E-9
HMMER bit score  :  28.1