Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:148238531-148238615
Genomic Sequence:  (84 bases)
ttccagtgtccggagtgtgacaagagctactgcatcagg
ggcagcttgaaggtccacttgtataagcacagtggagag
aggccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
FQCPECDKSYCIRGSLKVHLYKHSGERP
Stop codon count:  0
HMMER E-value  :  5.3E-10
HMMER bit score  :  30.8