Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:148238951-148239035
Genomic Sequence:  (84 bases)
ttctcctgcgccgagtgcggccgcagtttccgccgacgc
gcgcatctcacagagcacacgaggcttcacagtggcgag
gagccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
FSCAECGRSFRRRAHLTEHTRLHSGEEP
Stop codon count:  0
HMMER E-value  :  6.4E-13
HMMER bit score  :  40.5