Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:148239707-148239791
Genomic Sequence:  (84 bases)
tacccatgccctgagtgcgacaagaccttccggtacagg
gccaacctgaagaagcacctgtgtctacaccgcggggag
cggccg
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YPCPECDKTFRYRANLKKHLCLHRGERP
Stop codon count:  0
HMMER E-value  :  5.8E-13
HMMER bit score  :  40.6