Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr3:40504370-40504454
Genomic Sequence:  (84 bases)
tatgagtgtaaggagtgcgggaaagccttcagatggaat
gcaagtttcatccagcatcagaagtggcatactaggaag
aaactc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YECKECGKAFRWNASFIQHQKWHTRKKL
Stop codon count:  0
HMMER E-value  :  1.6E-16
HMMER bit score  :  52.4