Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr3:40504286-40504370
Genomic Sequence:  (84 bases)
tatgaatgccaggaatgtgggaagacattcagtcaaaag
atcactctggttcagcatcagcgagttcacactggggag
aaacct
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YECQECGKTFSQKITLVQHQRVHTGEKP
Stop codon count:  0
HMMER E-value  :  1.8E-19
HMMER bit score  :  62.3