Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr19:57561472-57561556
Genomic Sequence:  (84 bases)
tacaaatgtaatgaatgtggcaaggtctttagtctgctt
tcataccttgcacggcatcaaataattcatagtacagag
aagccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YKCNECGKVFSLLSYLARHQIIHSTEKP
Stop codon count:  0
HMMER E-value  :  6.3E-18
HMMER bit score  :  57.1