Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr19:57068499-57068583
Genomic Sequence:  (84 bases)
catgaatgcagtgtgtgcgggagagccttctccaggaaa
gcacagcttattcaacatcagagaactgaaagaggagag
aaaccc
Translated Genomic Sequence:  (28 residues; this is a NON-canonical finger sequence)
HECSVCGRAFSRKAQLIQHQRTERGEKP
Stop codon count:  0
HMMER E-value  :  8.2E-12
HMMER bit score  :  36.8