Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr19:57068331-57068415
Genomic Sequence:  (84 bases)
catgaatgtagtgaatgtggaaaagccttctccagaaag
tcacagctcatggtccatcagagaacccatacaggagag
aaaccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
HECSECGKAFSRKSQLMVHQRTHTGEKP
Stop codon count:  0
HMMER E-value  :  9.7E-20
HMMER bit score  :  63.2