Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr19:19651470-19651554
Genomic Sequence:  (84 bases)
tatgaatgtaaatactgtggaaaacctatcgattatccc
agtttatttcaaattcatgttagaactcacactggagaa
aaacct
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YECKYCGKPIDYPSLFQIHVRTHTGEKP
Stop codon count:  0
HMMER E-value  :  2.5E-14
HMMER bit score  :  45.2