Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:3426898-3426982
Genomic Sequence:  (84 bases)
tatacatgtagcatatgtggtagaggttttatgtggctc
ccaggattggcacagcatcagaaaagccacagtgctgaa
aacacc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YTCSICGRGFMWLPGLAQHQKSHSAENT
Stop codon count:  0
HMMER E-value  :  7.7E-11
HMMER bit score  :  33.6