Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:98815288-98815369
Genomic Sequence:  (81 bases)
tacaaatgtagcagttgtgaaagagtcttcagtcgtagt
gtccaccttactcaacatcagaaaattcacaaagagatg
ccc
Translated Genomic Sequence:  (27 residues; this is a canonical finger sequence)
YKCSSCERVFSRSVHLTQHQKIHKEMP
Stop codon count:  0
HMMER E-value  :  8.9E-9
HMMER bit score  :  26.7