Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:98815369-98815453
Genomic Sequence:  (84 bases)
tgtaagtgtactgtatgtggcagtgacttctgccatact
tcatacctacttgaacatcagagggtccatcatgaagag
aaagcc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
CKCTVCGSDFCHTSYLLEHQRVHHEEKA
Stop codon count:  0
HMMER E-value  :  2.5E-10
HMMER bit score  :  31.9