Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:98815933-98816017
Genomic Sequence:  (84 bases)
catgtatgtactgcatgtggtaaagccttcagtcatagc
tcagccattgctcagcatcagataattcacaccagagag
aaaccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
HVCTACGKAFSHSSAIAQHQIIHTREKP
Stop codon count:  0
HMMER E-value  :  1.1E-15
HMMER bit score  :  49.7