Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr7:98816187-98816268
Genomic Sequence:  (81 bases)
cattgctgcaatgaatgtgaaaaagccatcagtcaaaga
aactaccttgtttagtatcaaattcacgccatgcaaaaa
gat
Translated Genomic Sequence:  (27 residues; this is a NON-canonical finger sequence)
HCCNECEKAISQRNYLVZYQIHAMQKD
Stop codon count:  1
HMMER E-value  :  4.9E-5
HMMER bit score  :  4.9