Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:31674536-31674617
Genomic Sequence:  (81 bases)
tatagttgtagtaaatgtgaaaagagttttatccaaaat
ttagaacttaaaaatcaccatagagtttatagggaaacc
gac
Translated Genomic Sequence:  (27 residues; this is a NON-canonical finger sequence)
YSCSKCEKSFIQNLELKNHHRVYRETD
Stop codon count:  0
HMMER E-value  :  3.0E-5
HMMER bit score  :  7.0