Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:31673530-31673614
Genomic Sequence:  (84 bases)
cacagatgtaataatggtgagaaaatccttagtaaattg
tcaagtctaagaaaacataagataatccataatgaagag
aaacct
Translated Genomic Sequence:  (28 residues; this is a NON-canonical finger sequence)
HRCNNGEKILSKLSSLRKHKIIHNEEKP
Stop codon count:  0
HMMER E-value  :  2.1E-6
HMMER bit score  :  17.9