Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:31673446-31673530
Genomic Sequence:  (84 bases)
gccaaatgtaataagtgtatagaaacttttatccagtca
tcaaaacatactcagcctcagagaatccatattggagaa
aagtca
Translated Genomic Sequence:  (28 residues; this is a NON-canonical finger sequence)
AKCNKCIETFIQSSKHTQPQRIHIGEKS
Stop codon count:  0
HMMER E-value  :  1.3E-7
HMMER bit score  :  22.9