Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:31674286-31674370
Genomic Sequence:  (84 bases)
tacaaatgtaaagcatgtagcaaatctttctctcattcc
tcatgtctttctgtgcatcagataactcatactggaatg
aaacca
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YKCKACSKSFSHSSCLSVHQITHTGMKP
Stop codon count:  0
HMMER E-value  :  7.6E-16
HMMER bit score  :  50.2