Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:31673866-31673950
Genomic Sequence:  (84 bases)
tacaaatgtaaagaatgtggtaaatcatttaaagtgtct
tcagcccttactcagcatgagagaattcatactggagag
aaaccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YKCKECGKSFKVSSALTQHERIHTGEKP
Stop codon count:  0
HMMER E-value  :  5.0E-20
HMMER bit score  :  64.1