Motif identified by HMMER search
Type:  Finger
Genomic coordinates:  chr16:31674118-31674202
Genomic Sequence:  (84 bases)
tataaatgcaaagaatgtggcaaagcctttaattgtagt
tcacgccttactcaacatcaaagaattcataccggagag
aaaccc
Translated Genomic Sequence:  (28 residues; this is a canonical finger sequence)
YKCKECGKAFNCSSRLTQHQRIHTGEKP
Stop codon count:  0
HMMER E-value  :  1.2E-21
HMMER bit score  :  69.5